Vav3 Antibody 2398S from Cell Signaling Technology

Product Specs
ItemVav3 Antibody
CompanyCell Signaling Technology
Price Pricing Info Supplier Page View Company Product Page
Catalog Number2398S
Quantity100 µl
ApplicationsW
ReactivityH
TargetVav3
HostRabbit
NCBI Full Gene Namevav guanine nucleotide exchange factor 3
ClonalityPolyclonal
Research AreaCytoskeletal Signaling
Molecular Weight98 kDa

Add to Compare List

Cell Signaling Technology

3 Trask Lane

Danvers, Massachusetts 01923

United States

Phone: 877-616-CELL
Phone: 978-867-2388
Fax: 866-432-6112
Fax: 978-867-2488

Company Profile

Website: http://www.cellsignal.com/

Website: Technical Support

(1) VAV3 regulates glioblastoma cell proliferation, migration, invasion and cancer stem‑like cell self‑renewalMolecular Medicine ReportsMarch 22, 2023Rui Miao, Dong Huang, Kaitao Zhao, Yang Li, Xiaomei Zhang, Yi Cheng, Na Guofollows: Actin (1:1,000, cat. no. AA128; Beyotime Institute of Biotechnology), VAV3 (1:1,000, cat. no. 2398s, Cell Signaling Technology, Inc.), Nestin (1:1,000, cat. no. MAB5326, MilliporeSigma) and SOX2 (1:1,000,

(2) Identification of DNA response elements regulating expression of CCAAT/enhancer-binding protein (C/EBP) β and δ and MAP kinase-interacting kinases during early adipogenesisAdipocyteDecember 1, 2020Merrett JE, Bo T, Psaltis PJ, Proud CG.Primer (5ʹ-3ʹ) CREB,Cebpb CRE-60/106,CCCCGCGTTCATGCAC,CCACTTCCATGGGTCTAAAGGC CREB,Cebpb CRE -2343/2398,CATGGCCTATTGAGCAAAGAACC,ACCTCATCACAGAGCTTGGC CREB,Cebpd CRE −41,AAACCGCACAAACAGGAAGGAG,ACCGCCGCCTTTTCTAGC CREB,Mknk1

(3) Low expression of AIM2 combined with high expression of p‑STAT3 is associated with poor prognosis in hypopharyngeal squamous cell carcinomaOncology ReportsFebruary 25, 2019Zhen Li, Xinli Shi, Hui Li, Weiyi Wang, Xiaoming Licat. no. BE0021; Shenzhen Bioeasy Biotechnology Co., Ltd., Shenzhen, China). After washing for 2398 ONCOLOGY REPORTS 41: 2396-2408, 2019 Table I. Association of AIM2 expression with the clinicopathological

(4) Molecular characterization of EZH2 mutant patients with myelodysplastic/myeloproliferative neoplasmsLeukemiaSeptember 1, 2017J Rinke et al.EZH2 (#3147), 181 histone H3 (#9717), H3K27me3 (#9733), CXXC5 (#84546), ETS1 (#14069), VAV3 182 (#2398), GAPDH (#2118) (Cell Signaling Technology, Boston, MA, USA), FAM133B 183 (HPA043901) (Atlas Antibodies,

(5) YAP stabilizes SMAD1 and promotes BMP2-induced neocortical astrocytic differentiationDevelopment (Cambridge, England)July 1, 2016Huang Z, Hu J, Pan J, Wang Y, Hu G, Zhou J, Mei L, Xiong WC.before BMP2 treatment. After BMP2 (100 ng/ml) treatment, nuclear extracts were Development (2016) 143, 2398-2409 doi:10.1242/dev.130658 harvested for co-IP assays with anti-SMAD1 antibody (1:100, CST, #9743)

(6) Receptor-interacting protein-1 promotes the growth and invasion in gastric cancerInternational Journal of OncologyJune 1, 2016GUANGWEI ZHU, JIANXIN YE, YONGJIAN HUANG, WEI ZHENG, JIN HUA, SHUGANG YANG, JINFU ZHUANG, JINZHOU WANG-actin monoclonal mouse anti-human antibody (1:1,500) INTERNATIONAL JOURNAL OF ONCOLOGY 48: 2387-2398, 2016 2389 Table I. The gene name and sequence of primers, and the product length. 10% FBS for 24

(7) EXTENDED TRANSMISSION-LINE MODELLING OF INSET-FED RECONFIGURABLE RECTANGULAR MICROSTRIP ANTENNASProgress In Electromagnetics Research BJanuary 1, 2016Budhaditya Majumdar, Karu P. EsselleType Unbiased Forward Reverse Reverse Reverse Reverse Reverse Reverse Reverse ETLM 2435 2382 2490 2531 2052 2147 2187 2208 2228 CST 2372 2347 2392 2403 2069 2131 2164 2184 2205 % Devn. 2.66 1.49 4.10 5.33 0.82 0.75 1.06 1.10 1.04 Measured 2370 2350 2387 2398 2060 2135 2178 2203 2223 % Devn. 2.74 1.36 4.32 5.55 0.39 0.56 0.41 0.23 0.22 Table 3. Comparison

(8) ROS1 amplification mediates resistance to gefitinib in glioblastoma cellsOncotargetMay 4, 2015Hashim Aljohani, Robert F. Koncar, Ahmad Zarzour, Byung Sun Park, So Ha Lee, El Mustapha BahassiVav3 antibody, which recognizes endogenous Vav3 protein, (Cell Signaling Technology Inc. catalogue #2398). For DDR1 protein detection, we used DDR1 (D1G6, Cell Signaling Technology Inc. catalogue #5583) rabbit

(9) Synuclein Î³ protects Akt and mTOR and renders tumor resistance to Hsp90 disruptionOncogeneApril 30, 2015W Liang, S Miao, B Zhang, S He, C Shou, P Manivel, R Krishna, Y Chen, Y E Shishows the expression of immunoprecipitated Akt. © 2015 Macmillan Publishers Limited Oncogene (2015) 2398 – 2405 Synuclein γ as a target when inhibiting Hsp90 W Liang et al 2400 Figure 2. Protection of

(10) VAV3 mediates resistance to breast cancer endocrine therapyBreast Cancer ResearchJune 1, 2014Helena Aguilar et al.anti-phospho-serine 235/236 ribosomal S6 (D57.2.2E; Cell Signaling Technology), anti-VAV3 (07-464, Millipore; and 2398, Cell Signaling Technology), anti-phospho-tyrosine 173 VAV3 (anti-pT173 VAV3, ab52938; Abcam) and anti–tubulin

(11) Differentially Expressed miRNAs in Ewing Sarcoma Compared to Mesenchymal Stem Cells: Low miR-31 Expression with Effects on Proliferation and InvasionPLoS ONEMarch 25, 2014Bianca Karnuth, Nicolas Dedy, Tilmann Spieker, Elizabeth R. Lawlor, Stefan Gattenlöhner, Andreas Ranft, Uta Dirksen, Heribert Jürgens, Andreas Bräuningerand further analysed as previously described [28]. For detection primary antibodies against VAV3 (#2398; Cell Signaling) and as loading control Actin (C-11) (sc-1615; Santa Cruz Biotechnology, Santa Cruz, CA,

(12) Striatal D2 receptors regulate dendritic morphology of medium spiny neurons via Kir2 channelsThe Journal of neuroscience : the official journal of the Society for NeuroscienceFebruary 15, 2012Cazorla M, Shegda M, Ramesh B, Harrison NL, Kellendonk C.(1:1000, Cell Signaling Technology), anti-␣-tubulin (1: 2400 • J. Neurosci., February 15, 2012 • 32(7):2398 –2409 10,000, Sigma) and appropriate HRP-conjugated secondary antibodies. Films were quantified by

(13) The Role of Intermediary Domain of MyD88 in Cell Activation and Therapeutic Inhibition of TLRsThe Journal of ImmunologySeptember 1, 2011Monika Avbelj, Simon Horvat, Roman Jeralasamples and representative of at least three independent experiments. **p , 0.01, ***p , 0.005. 2398 cell lysate was then incubated with Ni-agarose beads and incubated overnight at 4˚C with gentle shaking.

(14) Synergistic Signals for Natural Cytotoxicity Are Required to Overcome Inhibition by c-Cbl Ubiquitin LigaseImmunityFebruary 26, 2010Hun Sik Kim, Asmita Das, Catharina C. Gross, Yenan T. Bryceson, Eric O. Long(EP1067Y), and pY731-c-Cbl (EP973Y) (Abcam); Anti-pY160 Vav1 (Biosource); and Anti-Vav1 (2153), Vav3 (2398), pY759 PLC-γ2 (3874), pY1217 PLC-γ2 (3871), pS473 Akt (9271), Akt (9272), pErk (9101), and Erk (9102)

Be the First to Write a Review!

Vav3 Antibody

Vav3 Antibody from Cell Signaling Technology

Description

Cell Signaling Technology

Citations (14)

Reviews

Vav3 Antibody from Cell Signaling Technology

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map